SHIELD #3: “Isaac Newton y el Método Científico”

Por
20
2418
Aviso de Spoilers: El artículo que sigue a continuación trata información de actualidad en Estados Unidos, por lo que puede desvelar detalles argumentales que todavía no han sido abordados en la edición española.

Desde el principio de los tiempos el hombre ha tratado de dominar las leyes que rigen nuestro mundo por medio del uso de la razón libre del subjetivismo implícito de nuestra propia naturaleza. En La Ética de Nicomaco, Aristóteles hablaba de la necesitad de establecer un método a base de reglas y axiomas con el que alcanzar la sabiduría mediante el conocimiento científico, del bien o de la felicidad. En la antigua grecia, él y sus predecesotes (Sócrates, Platón junto a otros muchos), fueron los principales responsables de alentar esta búsqueda de un dispositivo único que fuera válido en toda situación probable. Durante la edad media, científicos musulmanes como Alhazen o Avicena serían los principales responsables de su desarrollo hasta que, asimilado por estudiosos occidentales, Roger Bacon lo empleara para constituir las bases del método hipotético deductivo.

Sin embargo, no sería hasta la llegada de la Edad Moderna cuando René Descartes, uno de los principales impulsores de la filosofía natural, definiera por primera vez unas reglas del método para dirigir bien la razón y buscar la verdad de las ciencias en El Discurso del Método. En una época en la que el racionalismo y el empirismo estaban en plena pugna por la posesión de la verdad absoluta (igual que ahora se discute si es más fuerte Hulk o la Cosa, antaño el tema de moda friki era si era más importante la razón o los datos), la propuesta de Descartes no fue del todo bien recibida, sería el primer paso importante para establecer una metodología en la búsqueda del conocimiento.

Las grandes mentes renacentistas del siglo XV (Leonardo DaVinci, Isaac Copernico…) fueron grandes pioneros en la instauración de la metodología, obteniendo su verdadero desarrollo en su aplicación científica durante los siglos Siglos XVI y XVII gracias a Kepler, Galileo o Newton entre muchos otros.

A pesar de que dentro del método científico encontramos un amplio rango de variantes, el británico Francis Bacon estableció seis pasos con los que definió un sistema básico.

1. Aplicar atentamente los sentidos a un objeto o fenómeno mediante la observación, estudiándolos tal y como se presentan en la realidad.

2. Extraer a partir de observaciones y experiencias particulares, el principio particular de cada una de ellas por medio de la inducción.

3. Plantear una hipótesis mediante la observación siguiendo las normas establecidas por el método científico.

4. Probar la hipótesis por experimentación.

5. Demostrar o refutar (antítesis) la hipótesis.

6. Construir una tesis o teoría científica extrayendo las conclusiones.

Como uno de los responsables del descubrimiento del cálculo infinitesimal, la obra de Isaac Newton tendría un gran papel sobre la consolidación del método abriendo enormes perspectivas a la matematización y el calculo de funciones continuas aplicables a procesos naturales de cambio continuo. El padre de la ciencia moderna (del que ya os hablamos ampliamente en el resumen del primer número de la colección) es el protagonista de la entrega que nos ocupa y en la que se relata su andadura desde que fue reclutado por la Hermandad del Escudo hasta suceder a Galileo como actual Gran Maestre del Alto Concilio del IDEM. Con un arranque que establece evidentes paralelismos con la captación de Leonid en el debut de la serie, estamos ante un relato de búsqueda y obsesión en torno a las cinco claves según las cuales se accedía a la verdad suprema. Variante metahumana del método científica, el Quintuple Entendimiento es el proceso mediante el que el Alto Concilio maneja la realidad y gracias al que ha conseguido los logros que ha atesorado tras miles de años de existencia.

Como base fundamental del tercer número de la colección, a continuación os desgranamos cada uno de los pasos mientras acompañamos a Newton en su viaje en busca de la última verdad.

Nota: Pero antes de entrar en materia, os dejo la viñeta en la que se representa la iniciación de Newton ante el Alto Concilio. Muchas de las figuras que le acompañan me resultan treméndamente familiares más allá de una mera imagen del look de la época, pero soy incapaz de encuadrar con exactitud a que posibles personajes históricos pudieran estar dando vida. Ocurriéndoseme únicamente unos posibles Francis Bacon, John Locke y Nicolas Malebranche, aquí os la incluyo por si alguno tiene mejor pericia visual que yo:



LA MÁS NOBLE CIENCIA

Bagdad
Año 132 después de la Hégira
-750 según el Calendario Juliano-

El Califato Omeya había llegado a su máxima expansión extendiendo la palabra de El Profeta desde Samarkanda a Al-Andalus. Faro de luz y cultura en una época en la que la opresión, la barbarie y el ángel de la muerte campaban a sus anchas por Europa, su avance sería detenido por los francos en Poitiers mientras que, en Italia, las iglesisas romana y bizantina rompían relaciones siendo los últimos expulsados de la península por los Lombardos. Tras la insurrección de los Bereberes, los Abasíes derrocaban a los Omeyas tras la Batalla de Zab, trasladando la capital del Imperio desde Damasco a Bagdad.

Tras ser su padre ejecutado por participar en una conspiración contra los Omeyas, Abu Musa Jabir Ibn Hayyan Al-Azdi (también conocido como Geber) prosperaría como el más importante alquimista de la época actuando en la provincia de Jorasán. Revolucionario que cambiaría por completo el concepto de la alquimia gracias a su visión científica de la misma, era además heredero del legado de Imhotep así como uno de los principales cabecillas de la Hermandad del Escudo. Con las banderas negras todavía ondeando sobre los minaretes de Bagdad por los Omeyas caídos, Geber se disponía a construir la manifestación coherente de su sueño más recurrente: Un mundo que nunca tuviera final. Congregando la suma de sus esperanzas, sueños, anhelos e inspiraciones en un único ser, El Segundo Hombre. No otro que el mismo Geber, usaría dicho poder para crear una nueva Tierra para los mejores entre los hombres. Sin embargo, la experiencia colectiva resultaría terriblemente mal y un millar de los hombres destinados a dar forma a la sociedad perecerían dando inicio a la más oscura era que el hombre jamás haya conocido.

Líder espiritual y compañero del imán Ya`far as-Sadiq se convertiría en la principal referencia entre alquimistas de todo el mundo durante gran parte de la Edad Media. Geber puede considerarse uno de los primeros promotores del empirismo y el método científico gracias al fomento de una alquimia práctica más allá de la simple teoría. Dedicado estudioso de los textos de los grandes filósofos del mundo antiguo, escribiría un vasto número de tratados sobre temas como la astronomía, la física o las matemáticas. Una de las mayores fijaciones de su carrera sería el Takwin o la creación de vida, algo que el mismo Hickman plasma en estas páginas por medio de su infructuoso intento de crear un nuevo mundo. A Geber se le atribuye la creación de un gran número de utensilios de laboratorio como el alambique y la retorta así como el descubrimiento del ácido nítrico y el ácido clorhídrico, sin embargo, no esta del todo claro que todos los documentos que han llegado hasta nuestros días bajo su nombre pertenezcan a él. Durante el siglo XIII, un falso Geber fue responsable de numerosos manuscritos usurpando su identidad.

Como detalles referentes a la trama, en manos manos del acompañante de Geber puede verse el mismo escudo que daría nombre a su hermandad y que usara Imhotep para decapitar a la reina Nido. Y en lo que apuntes históricos respecta, las primeras referencias a Bagdad como ciudad datan del año 758 como obra del Califa Al Mansur, por lo que los datos no acaban de encajar a no ser que consideremos que dicha construcción fuera posterior a su destrucción tras el fallido experimento de Geber. Construida junto a los restos de Babilonia, fue durante casi 300 ininterrumpidos años (con la salvedad del traslado a Samarra) no solo la capital de los Abasíes y sus sucesores, si no también la una referencia cultural que rebosaba esplendor y sabiduría. Conquistada por los turcos Selyúcidas, la ciudad entraría en decadencia hasta ser arrasada por los mongoles de Hulagu Khan.



Roma
Año 1582 desde el nacimiento de Nuestro Señor Jesucristo

Sede del gobierno del Papado sobre las naciones cristianas de occidente, tras el esplendor que había vivido como capital del Renacimiento Italiano, Roma caería víctima de sus propias ambiciones entrando en un periodo oscuro de muerte, pillaje y enfermedad tras el saqueo de la ciudad a manos de las tropas de Carlos de Borbón. España se convertía en la principal potencia mundial bajo el reinado de Felipe II mientras que los Otomanos continuaban siendo la principal amenaza contra los reinos cristianos desde el Mediterráneo hasta los Carpatos.

Los grandes reinos de Europa acaparaban el poder económico y político mientras que el Vaticano se veía reducido a una farsa de influencia ficticia. Con su autoridad en entredicho, el cristianismo comenzaría a fragmentarse en un gran número de divisiones la mayoría de las cuales no reconocían al Papado. Esto permitiría que nuevas potencias como Inglaterra o el Imperio Ruso prosperasen extendiendo su influencia por el Atlántico o la Estepa Siberiana respectivamente.

Regresamos a los tiempos del Papado de Gregorio XIII, a la misma escena que dejáramos pendiente en el primer número de la colección. Galactus había aparecido sobre los cielos de la ciudad y, precedido por un misterioso heraldo se disponía a consumir nuestro planeta mientras el Patriarca del Escudo Galileo Galilei se prestaba a lanzar un aparatoso cañón contra él. Uno de los principales clifthangers del debut de la colección, nos quedaríamos sin saber como un par de tipos en leotardos pudieron derrotar al devorador de mundos… hasta ahora. Introduciéndonos a un nuevo personaje en escena, el Hombre Eterno (Forever Man), Hickman nos desvela como Galileo replicaría la experiencia de Geber construyendo una versión mejorada del artefacto del alquimista del medievo. Al igual que en aquella ocasión, las mentes de los miembros de la Hermandad del Escudo se conectarían al artilugio asumiendo Galileo el puesto que ocupara Geber. Cuerpo, mente y alma de los hombres más notables de la época se unirían en un solo ser creando un mundo en torno a Galactus mientras este iniciaba su proceso de digestión. El titán cósmico consumiría este mundo “imaginario” abandonando la Tierra tras quedar saciado. A pesar de la destrucción provocada sobre la ciudad y la muerte de dos tercios de los miembros de El Escudo, la Tierra se salvaría dando inicio a una nueva era de renacimiento y gobierno de la razón. Aquel sería el incio de La Más Noble Ciencia.

Nota: Queda sin confirmar todavía la identidad del hombre que surcaba los cielos como una bengala frente a Galactus. Pudiera ser el Hombre Eterno, pero su aspecto recordaba bastante más a la Máquina Nocturna/Máquina Noche. Según describiera el propio DaVinci, ambos parecen formar parte de lo que El Escudo denomina la Máquina Humana. Por lo que se entrevee entre la conversación entre el Hombre Eterno y Galileo, parece que el primero perteneció anteriormente a la Hermandad teniendo un gran conocimiento sobre el pasado de esta.



Interpretación de la Jugada

Atando datos entre las ideas vertidas en estas páginas y el complejo entramado de conceptos presente en el Universo Marvel, podemos llegar hasta una hipótesis bastante probable acerca del idílico takwin de Geber y como sus sucesores consiguen derrotar a Galactus gracias a una versión mejorada de su creación. Obsesionado con la idea de crear vida, por un sueño que le espoleaba incitándole a dar hálito a un nuevo mundo sin límites en el que los mejores de entre los suyos pudieran vivir en armonía, lo que el alquimista mahometano intentaba crear era, con gran certeza, una Uni-Mente.

Concepto bastante familiar para cualquier lector de los Eternos que se precie, se trata de una entidad puramente psíquica resultante de la fusión completa entre varios individuos que re-emergen en una nueva forma omnipotente. Las cualidades, el conocimiento e intelecto de sus integrantes se combinan en un solo ser de inconmensurable poder que, a partir de la fusión de sus dones puede acceder a nuevos niveles de entendimiento. Consumiendo una gran cantidad de energía para su creación, se trata de un proceso muchas veces irreversible que conlleva la perdida completa de identidad en aquellos que se integran en ella.

De forma generalmente esférica, como un pequeño satélite flotando sobre la superficie del planeta, es comprensible que Geber la definiera como “un nuevo mundo en el que las mejores mentes pudieran vivir en armonía”, forma muy lírica con la que describir el funcionamiento básico de la entidad. No en vano, a la Uni-Mente de Xandar que nutre a los Nova Corps se le ha denominado históricamente como Mundomente, por lo que es una visión bastante común de la misma. Existiendo teorías que postulan su posible relación con los Celestiales, numerosas razas a través del cosmos han sido capaces de crearlas como recurso ante la crisis. Aparte de Eternos y Xandarianos, la Inteligencia Suprema Kree puede considerarse una variante plastoide-artificial de la Uni-Mente como lo es su reverso Skrull Inteligencia. Poseedor de su propia Mundomente, el planeta K’ai sería capaz además de desarrollar a las implacables Menteguerra, conglomerados de naturaleza similar creados para defender el núcleo esencial de su planeta.

Dados sus atributos, podría postularse que Gea es la Mundomente original de nuestro Planeta implantada por los Celestiales al comienzo de los tiempos. Los artrópodos de la Tierra concebirían una millones de años atrás (la Mundocolmena de la Tierra) mientras que la especie humana ha flirteado con el intento en diversas ocasiones. Uno de los más rádicales sería el provocado por la miembro de los Jóvenes Dioses Varua, cuyo poder otorgado por los Celestiales le permite precisamente crearlas y, recientemente, trataría de unificar las consciencias de toda la humanidad en una sola Uni-Mente mediante la que dar vida a un nuevo Celestial terrícola.

Según Ross y Krueger asentaron en Tierra-X, cuando Galactus se alimenta de un planeta lo hace fundamentalmente de esa energía dejada por los Celestiales que, además de ser responsable de la vida sobre su superficie, emerge tras el paso de varios eones como un nuevo Celestial. Combinando esta idea con las Uni-Mente y Mundo-Mentes, es muy probable que estas sean en esencia la energía de la que se nutre el Devorador de Mundos. Creándola entorno a Galactus cuando este da comienzo a la digestión de nuestro mundo, la Uni-Mente artificial es consumida en su lugar protegiendo al planeta de su inconmensurable apetito.



El Calendario Gregoriano

La necesidad de un calendario solar que tuviera en cuenta las estaciones del ciclo solar dio pie a que los antiguos calendarios lunares fueran desapareciendo a favor de sistemas de división del tiempo más prácticas. Los primeros en implantarlos serían los Egipcios para adelantarse a las crecidas del Nilo, pero no sería hasta la tiranía de Julio César sobre Roma cuando se estableciera de forma oficial. Sin embargo, el Calendario Juliano tenía un problema de base al considerar que el ciclo solar es de 365.25 días cuando en realidad es de 365,242189 (365 días, 5 horas, 48 minutos y 45,16 segundos). Lo que a priori no parece tan importante, al cabo de mil seiscientos años supondría un desfase acumulado de 10 días, algo fatal para la agricultura, la pesca y otras profesiones dependientes de las estaciones. Durante el papado de Gregorio XIII esto sería solventado gracias a la introducción en 1582 de un nuevo calendario que daría fin al problema.

¿A qué viene todo esto? Una de las reticencias originales hacia la obra por cierta parte del fandom fue la revelación de una llegada de Galactus a nuestro mundo anterior a su debut en el número 48 de los Cuatro Fantásticos. Si el devorador de mundos llegó a la Tierra, no ya en una época oscura de la humanidad en la que la tradición escrita era un bien excaso, si no en pleno renacimiento en el que prosperaran tratados y documentos de los más variados temas, ¿cómo no ha llegado hasta nosotros ninguna mención al respecto? Hickman solventa esta incognita de forma ingeniosa por medio de la implantación del Calendario Gregoriano haciendo a Galileo y su Hermandad del Escudo los principales responsables de esto (espero que Christopher Clavius forme parte de ellos, no es cuestión de andar quitándole méritos a estas alturas).

Galileo le propone a Gregorio XIII la implantación de este nuevo calendario con la doble función de eliminar el desfase y de paso, cualquier documento que pudiera hacer referencia a la catástrofe de la ciudad eterna. Sin aprobar del todo los actos de la Hermandad del Escudo al usurpar funciones que solo deberían corresponder al altísimo, el papado aprobaría la reforma volcando todos sus esfuerzos en borrar cualquier registro que hiciera referencia a la llegada de Galactus. Desde aquel momento y hasta la posteridad, 10 días desaparecieron de los anales de la historia.

Nota: El avistamiento de Galactus en Roma y la posterior destrucción de parte de la ciudad tiene lugar en un periodo oscuro de la urbe y que abarca desde su saqueo a manos de tropas germano-españolas hasta e finales del Siglo XVI. Durante el mandato de Gregorio XIII, se convertiría en un lugar tan caótico y peligroso que Montaigne llegó a escribir que las vidas y los bienes nunca habían encontrado un entono más dañino que la ciudad de Roma en tiempos de Gregorio XIII. Pillaje, prostitución, miseria y una perdida completa de un norte moral que terminaría con la llegada de su sucesor Sixto V. Responsable de replantear el casco urbano de la ciudad, ahora sabemos que la principal causa de ello fueron los efectos de la batalla contra Galactus. Con la pérdida de miles de vidas, al menos se puso fin al crimen que medraba en la ciudad, macabra solución para la escoria que la azotaba.



Urbis Inmortalis

Principal impulsor de separar la ciencia del dogma, la fé y la autoridad, durante sus último años de vida Galileo Galilei entraría en conflicto con la autoridad eclesiástica, siendo obligado a permanecer bajo encierro domiciliario a raíz de sus revolucionarias ideas sobre la estructura del sistema solar. O al menos, eso es lo que pensábamos. Ahora sabemos quea finales del Siglo XVI, la Hermandad del Escudo pasó a operar desde el más absoluto anonimato construyendo la que desde entonces se convertiría en su sede central: Urbis Inmortalis.

Alojada entre el complejo laberinto de capas arquitectónicas que componen el subsuelo de la ciudad milenaria, constituye una ciudad dentro de otra ciudad, en la que dar rienda suelta a las más increíbles maravillas que el hombre jamás haya imaginado.

Nos encontramos en la Roma que se aproximaba al inicio de un nuevo siglo de barroquismo, revolución científica y crisis generalizada. Hablamos de los años en los que España había sufrido su primera gran derrota con el fracaso de la Armada Invencible, en los que el Imperio Otomano encontraba una oposición seria en oriente con el alzamiento del Imperio Safawi y la invasión de los japoneses liderados por Hideyoshi contra la china Ming. Con la consolidación del poder de la Iglesia Anglicana en Inglaterra tras la ejecución de María Estuardo, el fin de las guerras de religión francesas con la coronación de un protestante Borbón y el fracaso en reinstaurar el catolicismo en Suecia, la Iglesia Católica ve como su poder es cada vez menor en la esfera de influencia europea. La inquisición continúa causando estragos en España, mientras que el Conde Otto Von Muerte prosigue sus maquinaciones desde centroeuropa y Elizabeth I de Inglaterra se acerca al final de su reinado. En apenas dos años un bajel llegará a tierras británicas desde la colonia de Roanoke trayendo consigo a la joven Virginia Dare y a un indio de tez blanca y cabellos rubios.

Es en este entorno en el que Newton y otras de las grandes mentes de su época llegan a Urbis Inmortalis para convertirse en la nueva generación de genios que den forma al mundo.

LAS ARTES OCULTAS

Año 1625. Los Manchúes inician la conquista del Imperio Ming, mietras que, en Europa, la Guerra de los 30 años debilita seriamente el poder de España dando a paso a tres nuevas potencias que a partir de ahora regiran la escena mundial. Francia comienza a establecer colonias desde Quebec hasta el Caribe mientras que, Inglaterra y Holanda entablan una seria pugna por el control del comercio marítimo arrebatándole el control a Portugal. Expulsados de las Indias Orientales por los holandeses, los británicos comienzan a establecerse en la costa atlántica de norteamérica con la llegada del Mayflower.

Nos encontramos en el año anterior a la fundación de Nueva Amsterdam mientras Isaac Newton continúa con sus experimentos bajo el auspicio de la Hermandad del Escudo. Lastrado por las estrictas reglas de la Hermandad, Newton se ve incapaz de explotar todo su potencial en una búsqueda que le ha estado obsesionando durante años. Consciente de la frustración de su pupilo, Galileo decide enviarlo en un viaje a través del mundo que terminará con su llegada a la ciudad desviante de Ashomia, aparentemente situada sobre el macizo montañoso del Himalaya.

Capturado por las tropas de la ciudad, sería aceptado entre los Desviantes por su estructura genética única, obligándole a aparearse con la bestia Morga. Durante los meses siguientes, Newton padecería las más abominables indignidades de su raza y sus corruptas creencias hasta finalmente poder acceder a su Libro Sagrado, escrituras en las que se conservaba un conocimiento único, alienígena y devoto, que había sido conservado por los Desviantes durante miles de años. Tras matar a sus guardianes, Newton transcribiría todo su conocimiento sobre su propio cuerpo canibalizando el poder del libro antes de destruir la ciudad Desviante. Regresando junto a la Hermandad del Escudo daba así por completo el segundo punto de la Quíntupla del Conocimiento, las Artes Ocultas.



Ashomia, Ciudad Desviante

Tanto el entorno en el que se situa la ciudad de Ashomia como los motivos que conforman la decoración de sus calles y las ropas de sus habitantes hacen sospechar que ésta se sitúa en el Himalaya. Nos encontramos así con un paisaje escarpado y rocoso cubierto de nieve rodeando una ciudad en la que abundan estatuas con forma de dragón y edificios con forma de pagoda. Además, el soberano desviante luce un bigote Fu-Manchú además de aparecer ataviado con complementos que recuerdan poderosamente a los ataviajes de los líderes tribales de la zone de influencia de la cultura China (Manchuria, Mongolia, Tibet, etc…).

Teniendo en cuenta esta ubicación, es inevitable que nos evoque a Attilan, ciudad Inhumana que antaño estuviera igualmente en uno de más recónditos rincones de la región. ¿Dos ciudades ocultas en el Himalaya? A principio parece excesivo, si, pero teniendo en cuenta lo inhóspita e inaccesible de la región, bien podrían existir diferentes simsd donde erigir una colonia lejos de los ojos del mundo. Otra posibilidad aun más interesante sería que, considerando que Ashomia fue aparentemente destruida por Newton y que Attilan no fue establecida en la región hasta mediados del siglo XX, quizás esta última se asentara sobre los restos de la primera. No en vano, tengamos en cuenta tanto las criptas en las que habitaba la casta los Alfa Primitivos como la relación del científico inhumano Phaeder con los incansables enemigos de los Eternos. Este último detalle es todavía más relevante si tenemos en cuenta que Phaeder tuvo a Maelstorm, el villano nihilista heraldo de Oblivion, junto a una desviante llamada Morga. ¿Podría tratarse de la misma con la que se aparea el descubridor de la Ley de la Gravedad?



El Libro de los Sueños

Si en el post del segundo número de la colección ya hablábamos de la posibilidad de que el libro que aparecía cortejado por sacerdotes Desviantes en los sueños de Leonid fuera el Libro de Krask, esta nueva entrega parece confirmarlo.

Sagradas escrituras de la raza Desviante, fueron acuñadas tras la llegada de la Segunda Hueste y el consiguiente colapso de la cultura que habían erigido como raza dominante de nuestro planeta. Creados a partir de proto-homínidos terrícolas en los que los Celestiales vieron potencial de futuro, son la variante deforme de los apolíneos Eternos, caracterizándose por sus capacidades reproductivas y por el hecho de que cada uno de ellos tenía una forma, atributos y dotación genética diferente de los demás. Con retorcidas formas monstruosas que desafiaban a la imaginación, mientras que los Eternos se mantuvieron por siempre como un mero centenar de individuos, los Desviantes medrarían hasta alcanzar cifras superiores a varios múltiplos de millón.

Creando una civilización propia que entraría en guerra con los Eternos, la llegada de la Segunda Hueste arrasaría todo su imperio hasta reducirlo a una pira humeante en el fondo del Oceáno Pacífico. Sobreviviendo únicamente unos cuantos miles, se ocultarían bajo la superficie terrestre. Según las tradiciones Desviantes habían sido sembrados por los Celestiales, reinjertados a partir de la plantilla humana, para que prosperasen y se multiplicaran el mundo hasta que, en su regreso, los colosos cósmicos los consumieran como caviar.

Considerándose a si mismos como el alimento de los dioses, el Libro de Krask habla de como hubo fuego en los cielos, y con él llegó una gran destrucción. Sin embargo, el más grande y brillante entre ellos, Tiamut, el Celestial dorado que había creado a los Desviantes en el amanecer de los tiempos, se opondría a sus hermanos rechazando semejante aberración.

“Dejad a mi gente ser, dijo él. ¿Por qué no debo dejarlos dominar la Tierra y todo lo que hay sobre ella?”

Pero según reza la tradición Desviante, el resto de los Celestiales se volvieron en contra de Tiamut, y entonces hubo una terrible lucha tras la que este terminó enterrado bajo tierra en lo que hoy es la Bahía de San Francisco. Y el que antaño brillaba como el sol, ahora era oscuro como el carbón. Y continúa soñando en su prisión, hasta que un día las cosas cambien y él regrese para guiarlos en una nueva era en la que la raza Desviante recuperará toda la gloria maldiciendo a los Celestiales. Hasta entonces, continuarán orando al que duerme en la oscuridad y que vela por ellos hasta la llegada del fin del mundo.

Todas estas creencias serían recogidas en el Libro de Krask, un tomo único jamás copiado ni jamás compartido cuyo poder bebía directamente del Celestial Durmiente. Compendio del saber y las artes acuñados por los Desviantes a través de eones ahora sabemos que a mediados del siglo XVII caería en manos de Isaac Newton, quien abusaría de su confianza arrebatándole todo su contenido y poder dejando únicamente un libro vacío. Deshaciendo todo su texto para inscribirlo en su propio cuerpo (con un método similar al que Mordred el Místico usara con el Darkhold en la primera saga de los Poderosos Vengadores de Slott) accedaría a su poder enraizado en las más antiguas artes, arrasando Ashomia después.

Parte de las escrituras se conservarían hasta nuestros días y, en plena Guerra Civil superhumana verían como estas comenzaban a hacerse realidad con la llegada de Skadrach y el alzamiento del Celestial. Según reza La Perdición de Skadrach (uno de los capítulos del Libro de Krask que llegaría como una canción infantil) un Eterno poseería el espíritu del Celestial Durmiente. Y entonces, todo lo que amaba le odiaría; y quien le reverenciase, comenzaría a despreciarlo. Porque todo por lo que alguna vez le importara sería destruido, y solo cuando todo terminase, podría haber un principio.

Estas creencias probaron ser en gran parte ciertas tras el prometido alzamiento de Tiamut en páginas de los Eternos de Gaiman y sus sucesores los Knauffs. A pesar de que algunos de los detalles no eran exactamente como los extractos conservados del Libro de Krask indicaban (los Celestiales no se alimentan de Desviantes, si no que usan a la Horda para cosechar la energía que ellos mismos siembran en los mundos por los que pasan) ni supuso el resurgir de su raza, si que traería una nueva esperanza de futuro para nuestro planeta salvándolo de un inminente holocausto. El Eterno Makkari si convertiría en Skadrach y Tiamut se enfrentaría a El Que Está Por Encima de Todo mismo entregándole a la Tierra una nueva esperanza de cara al futuro.

Como inciso, cabe destacar que los Desviantes han orado devotamente a Tiamut durante milenios y que abrazaban su culto desnudos, en toda su pureza, a la hora de acceder a sus escrituras.



Amor entre especies

Atando cabos entre las visiones de Leonid durante el número anterior y los sucesos de este que nos ocupa, podemos llegar a la conclusión de que Morga es la madre de Leonid y, por tanto, Isaac Newton su verdadero padre. Inducida en la mente de Leonid cuando DaVinci estimulaba sus recuerdos más profundos, en ellos veíamos a Morga desnuda en actitud receptiva además de a varios Desviantes orando en torno al Libros de Krask y, finalmente, el tomo en blanco con varias manos sobre él. Creyéndose a si mismo hijo de la Máquina Nocturna, en el resto de su visión veíamos como era entregado a al Hombre Eterno y como se integraban junto al primero de ellos y una mujer de aspecto aureo en una misteriosa máquina (¿La tan cacareada Máquina Humana?)

Cuando Newton llega a la ciudad, vemos como el soberano desviante lo contempla pronunciando “ATATTAATCGGCCGGCGCTAATTA”. Esto no es ningún vocablo extraño de una lengua muerta antidiluviana, sino que se trata de una cadena de nucleótidos -la base de la vida- identificados por sus correspondientes bases nitrogenas (Adenina, Tiamina, Citosina, Guanina) que conforman las cadenas de ADN cromosómico. El soberano desviante está leyendo su dotacion genética antes de decidir si acogerle o no, de ahí que haga el comentario sobre su “secuencia única”, por lo que se deduce que Newton poseía algún tipo de cualidad enterrada en sus genes y de ahí que lo envíe a aparearse junto a Morda para obtener un preciado fruto.

En una escena poco común en el mainstream americano, vemos a Newton copulando con Morda dejando a esta encinta (visible en la siguiente viñeta en la que muestra su estado sin ningún tapujo) antes que este arrase la ciudad y, supuestamente, que Morda de a luz a Leonid.

Como curiosidad, aunque Marvel se ha atrevido a lanzar la escena no lo ha hecho sin cierta censura. Según comenta Dustin Weaver en su web, pretendia que la escena fuera a la vez grotesca, un poco sexy y ante todo perturbadora. “A veces ser más o menos explícito con ciertos elementos puede tener beneficios en la narración narración, y este era uno de esos casos” Sin embargo, Marvel no ha pensado lo mismo y ha decidido emplear el metodo “edredoning” para quitarle algo de carga sexual a la escena. El dibujante dice entender la decisión de la compañía, pero que aun así no la comparte. Weaver afirma que el sexo es parte de la vida y que debería aceptarse de forma natural, ya que diariamente nos bombardean con él en los comics de forma velada a base de formas y poses sugerentes. Para que podáis comparar. aquí os dejamos la ilustración original y la versión final de la misma:

Aviso de Spoiler


LA ALQUIMIA SECRETA

Francia, 1652. Nos encontramos en el séptimo año del reinado del Rey Sol. La Guerra de los 30 Años ha llegado a su fin tras la firma del Tratado de Westfalia otorgándole a la Francia de Nazarino la hegemonía en el continente europeo. Carlos I es ejecutado estableciéndose la Commonwealth, Inglaterra entra en guerra con Holanda. En el norte de Europa Suecia aumenta su poder entrando en conflicto con Rusia como esta última lo hace en el Pacífico con los Manchúes, nuevos señores de China. El gobierno de Tokugawa Ieyasu expulsa a los extranjeros de Japón y, en Oriente Medio, el Sultán Otomano Ibrahim es ejecutado por los Jenizaros un par de años después de firmar la paz con el Imperio Safawi.

Nostradamus reposa en su estudio en brazos del opio y sus concubinas cuando uno de sus asistentes le avisa de la llegada de Newton cortejado por los hombres del Escudo. Nostradamus solicita a sus acompañantes que le abandonen mientras recibe a Newton llamándole hechicero con aparente condescendencia. El británico hace caso omiso a sus palabras alardeando de haber encontrado algo increíble gracias a lo que ahora dispone del tiempo para todas sus palabras retorcidas y adivinaciones. Nostradamos le contesta aludiendo “Ahora profeta, el hombre una vez fuera vidente… y no soy nada semejante”. Tras esto, Nostradamus se entrega reconociendo saber la razón de su visita y que por ello se sabe condenado. Newton ordena a sus hombres que le apresen.

Varios siglos más tarde vemos a Newton frente a Nostradamus en la prisión de este último con su aureo brevaje entre las manos. La Alquimia Secreta. El tercer punto de la Quintupla del Conocimiento responsable del Elixir de la Vida que fluye desde la rueda del mundo.

LA MATEMÁTICA DISCRETA
–2060–

Gracias a la perspectiva de la inmortalidad y a su dominio de los tres primeros pasos del Quintuple Entendimiento, Newton ha conseguido encontrar respuesta a la ecuación cuya resolución le ha estado atormentando desde antes de unir fuerzas con la Hermandad del Escudo.

¿El resultado? Un número tan concreto como contundente 2060. La fecha exacta en la que el mundo llegará a su final y que convertirá todo esfuerzo de la Hermandad en una mera anhelo de esperanza impotente ante el cataclismo que vendrá. ¿Estará relacionado con el famoso vaticionio que Richards y el Mago compartían en las páginas de los Cuatro Fantásticos? Solo el tiempo lo dirá.

Usando símbolos matemáticos, astrológicos, alquímicos e incluso signos todavía más complejos, Dustin Weaver nos deja en su web, para todo el que pueda estar interesado, la fórmula completa que le lleva a Newton a su descubrimiento. Si hay algún matemático en la sala que se atreva a intentar descifrarla bienvenido sea.




Nota: Como curiosidad, la frase pronunciada por Newton durante este pasaje es una cita de Gottfried Leibniz, quien durante un largo tiempo sería rival de Newton.

LA VERDAD SILENCIOSA

Cada uno de los pasos dados por Newton le conducen hasta una aterradora verdad que cambia el campo de juego por completo desde ese momento hasta el final de los días dando validez a todo en lo que ha creído. El viejo orden ha de extinguirse dejando paso a la nueva sangre. Todo cambio tiene un coste, y el precio debe ser pagado.

Aviso de Spoiler

Y con esto termina el viaje de Isaac Newton para completar la Quintupla del Entendimiento accediendo a la gran verdad que terminaría con su alzamiento como Patriarca de la Hermandad del Escudo. Solo él es consciente de la inevitabilidad del maremagnun al que se aproximan, y por lo tanto solo él tiene derecho a alzarse como líder al frente del Escudo. El comic termina con la misma escena que arrancaba el segundo número de la colección visto desde la perspectiva de Sir Isaac quien, desde la catacumba en la que retiene a Nostradamus, llega a la sala donde aparecen DaVinci y Leonid unas palabras en siniestra contraposición a las pronunciadas por Galileo al inicio del comic.

Aviso de Spoiler


“Soy Isaac Newton.
Algunos hombres me conocen como hermano…
tú lo harás como amo”

Términos como “difícil” o “díscolo” se quedan francamente cortos a la hora de describir el carácter de Sir Isaac Newton. Nacido prematuramente en la navidad de 1643, nunca conoció a su padre siendo abandonado por su madre al cuidado de sus abuelos cuando solo tenía tres años. Desheredado por estos ante su actitud esquiva, amenazaría a su madre y su padrastro con quemarlos en su propia casa. De temperamento fuerte y en ocasiones violentas, no congeniaba demasiado bien con los críos de su edad, quienes tendían a desconfiar de él. Como alumno universitario, Newton se matricularía con unas notas mediocres al pasar más tiempo en la biblioteca que asistiendo a clase. Sin demasiado interés por el sexo femenino, brillaría con sus inventos y hallazgos entrando en contacto con la Royal Society a varios de cuyos miembros no dudó en criticar ferozmente. Newton mantuvo intensas polémicas con Robert Hooke, el citado Leibniz y, especialmente, la Iglesia de Roma, a quienes acusó de violar las sagradas escrituras. Como presidente de la Royal Society llegó a ser descrito como un dictador cruel, vengativo y busca-pleitos. Emprendiendo sus estudios sobre la ley gravitacional únicamente para superar a Hooke en un prooblema que este nunca consiguió solucionar, entre sus excasos amigos estaría el filósofo John Locke, quien tampoco se salvaría de sus críticas.

En resumen, el caracter que el Newton real mostrara en la vida real encaja mucho con la variante ficticia que nos presenta Hickman en sus páginas. Y es que aunque son personajes inspirados en figuras reales cabe recordar que como el propio guionista manifestó en sus primeras entrevistas, esta era una obra básicamente de ficción en la que se tomaría numerosas licencias con los personajes adaptados. La más sonada hasta el momento es sin duda la referente al propio Newton, pues, ateniéndonos a la figura real, la mayoría de los datos que se le atribuyen en este número son inviables. Basta con resaltar (por si no habéis echado cuentas), que Newton nación un año después de la muerte de Galileo y, sobre todo, después de todas las fechas en las que tienen lugar los viajes que realiza en este número. Nacido en 1643, en el 25 de ese mismo siglo difícilmente estaba disponible para fornicar con desviantes o, en el 52 (con solo 9 años) para apresar a Nostradamus.

Quizás errata, quizás licencia o quizás Hickman está dándole una nueva forma al progenitor del propio Newton (también de nombre Isaac), pero no deja de ser una llamativa curiosidad frente a una historia realmente apasionante.

Como final de nuestro resumen del número #3 de la colección, os dejamos un preview del número #4 de la misma que bajo el título “La Locura, El Niño Estelar y la Madona Celestial” pretende adentranos en la vida y obra de Nostradamus así como presentarnos otra de las ideas radicales del guionista: El Feto de Dios. Ya a la venta en el mercado USA, lo tenéis a vuestro alcance cualquiera que sigáis la colección por catalog Preview. Bon Appetit!


20 Comments
Antiguos
Recientes
Inline Feedbacks
View all comments
salebaaay
salebaaay
Lector
7 octubre, 2010 22:32

esta serie esta buena, las unicas fallas que le veo es que es un poco lenta la trama y cansan ver los mismos escenarios casi en los 3 numeros, y muuchas palabras
de todo lo demas es muy buena y es interesante y fresca la propuesta y el dibujo es bueno y fluido, buen review

Anónimo
Anónimo
Lector
8 octubre, 2010 0:36

Buff por lo visto hay que sacarse un master de “Universo Marvel para principiantes” para leer esta serie…

Diomedes
Diomedes
8 octubre, 2010 1:07

No ,porque nada de lo que estan contando estaba en continuidad….es todo creacion nueva.
 
Resta ver si esto se trasladará a la continuidad Marvel tradicional ..

billyboy
billyboy
Lector
8 octubre, 2010 1:13

La escena censurada con la original tampoco cambia tanto,me parece una idiotez la censura a la imagen,para eso que directamente Marvel le pidisese que solo se comentara tal relacion,porque ya ves tu.
 
Mi apoyo a Weaver,toda la razon del mundo,nos venden sexo en los comics pero despues se echan para atras si alguien va un poco mas alla (que tampoco es que se pasase mucho,cosas peores e visto en Ultimates 3)

xaho
xaho
8 octubre, 2010 1:23

aqui, me quito el sombrero, sr. daniel
Términos como “maraviloso” o “increible” se quedan francamente cortos a la hora de describir su articulo

xaho
xaho
8 octubre, 2010 1:27

ummmm, interesante seria reeler toda las historias parlelas a las sagas de atlantis ataca y la guerra de la evolucion, donde se narra con bastante exactitud historica la creacion de la tierra, el origen de desviantes y eternos, la caidad de la atlantida, las primeras unimentes contra celestiales y esas cosas para ir encajando conceptos

Nowhere Man
Lector
8 octubre, 2010 4:12

Increíble el articulo, de no ser por este se me pasarían muchos datos,
Se necesita ser una eminencia en la historia y ciencias de la humanidad, como ser un erudito en las historias de Marvel comics. Hickman Unió las dos, y creo una gran Obra maestra, narrada como si fuera una Epopeya Epica.

dr. ch
dr. ch
Lector
8 octubre, 2010 6:51

yo opino que el tp de esta serie tiene que venir con un agregado con estos articulos! son brillantes y se ponen al nivel mismo de la serie
genial, los felicito sinceramente por su trabajo!

Goku_Junior
Lector
8 octubre, 2010 10:22

Pedazo articulo  describen este pedazo articulo Daniel, le das mucho más sentido a esta serie bastante extraña y absorvente. Despues de haber leído el número 3 y leer este artículo la verdad es que sigo sin entender muy bien a donde quiere llegar Hickman y eso es lo que más me atrae de este comic. Lo que esta contando ¿afectará en algo al presente? ¿se quedara en algo así como “la historia secreta de SHIELD”? demasiadas preguntas quedan aún.
 
Por cierto, la serie es bimestral o algo así ¿no?

luisfernandogcruz
luisfernandogcruz
8 octubre, 2010 11:16

Dios, que le den a Hickman las llaves del reyno por algunos meses XDDD, exelente articulo, creo que es de las mejores series que hay actualmente, muy por el nivel de casi todo ene l mercado.

I´m with a Skrull!
Lector
8 octubre, 2010 11:20

Si le dan a Hickman las llaves del reino, se puede preparar la industria del comic, “erase una vez un hombre con un plan, escribir comics con historia, más alla de los anillos y los alienigenas y los crossovers y los no muertos… llegó Hickman, e hizo una gran proeza, kick asses!”
Eso si que seria un editor en jefe, plan editorial? este, alguno ha visto la biblia que tenia preparada para los secret warriors? en un año teneis que desarrollar esto, hasta aqui, y sin retrasos gente, que para el año que viene toca esto.
Qué bonito es soñar.

luisfernandogcruz
luisfernandogcruz
8 octubre, 2010 11:33

Pues mira me agrada mucho bendis, se me hacen diertidos sus avengers, pero no estaria mal un rato hickmn para ponernos serios, ademas el tio puede hacer cosas comerciales, ademas imaguinate a bendis-millar-hickman-loeb…. seguro vuelven a hacer algo tanimpactante como civl war………..

Goku_Junior
Lector
8 octubre, 2010 12:47

“Hickman está engarzando muchos detalles con Secret Warriors y los Cuatro Fantásticos por lo que todo parece una macrohistoria gigantesca ”
 
Justo lo que me imaginaba 😉 , joder este tío es la ostia, con los 4 Fantásticos lo está haciendo muy bien, con personajes desconocidos y conocidos en Guerreros Secretos más de lo mismo y aquí idem. Espero que Panini la edite en grapa.

Maesemediarock
Maesemediarock
8 octubre, 2010 13:20

Estos artículos se salen, me parecen el cpmplemente perfecto para la histoira de los números que están sacando.
Pedazo de curro, eres un crack.

AitorIriarte
8 octubre, 2010 15:46

La respuesta a esa formula y a todo es 42.
xd

Tiegel
Tiegel
8 octubre, 2010 15:52

me estoy 42

xaho
xaho
8 octubre, 2010 16:32

– Hola suelo !!!!
 
 
– No! otra vez no!

Elios
Elios
9 octubre, 2010 9:36

Como siempre, increíble artículo, Daniel:D